View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5802_high_1 (Length: 270)
Name: NF5802_high_1
Description: NF5802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5802_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 21 - 158
Target Start/End: Original strand, 47424198 - 47424335
Alignment:
| Q |
21 |
tatgagtaaaaagaatttttacaaaactcttatggtaagacttgacttattatcactnnnnnnntccaacaatatcgtttaaaatcacatttggagaaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
47424198 |
tatgagtaaaaagaatttttacaaaactcgtatagtaagacttgacttattatcactaaaaaaatccaacaaaatcatttaaaatcatatttggagaaca |
47424297 |
T |
 |
| Q |
121 |
atctatcaaaatttaaccgttattgtacaatataaggt |
158 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47424298 |
atctatcaaaatttaaccattattgtacaatataaggt |
47424335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 226 - 261
Target Start/End: Original strand, 47424403 - 47424438
Alignment:
| Q |
226 |
tacttcctaattacatccatccctatactttcatct |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47424403 |
tacttcctaattacatccatccctatactttcatct |
47424438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University