View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5803_high_30 (Length: 239)
Name: NF5803_high_30
Description: NF5803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5803_high_30 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 5829536 - 5829753
Alignment:
| Q |
18 |
tgtgcttggtattgtttcatttttatgttatgtaatatgtttacaatttcaaatttcagatttgtttaagttcttggtaactcatttgatatctatcgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5829536 |
tgtgcttggtattgtttcatttttatgttatgtaatatgtttacaatt-------tcagatttgtttaagttcttggtaactcatttgatatctatcgta |
5829628 |
T |
 |
| Q |
118 |
aattttgtatcaataaattatgtacttgcttaaaacaatgatgtatcataaat---gatcatatttgattcccctttgtcttaatgctgaaggaaccgtt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5829629 |
aattttgtatcaataaattatgtacttgcttaaaacaatgatgtatcataaattaagatcatatttgattcccctttgtcttaatgctgaaggaaccgtt |
5829728 |
T |
 |
| Q |
215 |
aatagacttgtcggtggtactttct |
239 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
5829729 |
aatagacttctcggtggtactttct |
5829753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University