View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5803_low_13 (Length: 385)
Name: NF5803_low_13
Description: NF5803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5803_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 348; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 23 - 378
Target Start/End: Complemental strand, 54314864 - 54314509
Alignment:
| Q |
23 |
cataatttaataagtaggatgtttctttttcaaagaagtcagaaaaggccaaaatctatcggaacaattaggtacctttacattcattgtaggatccgta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54314864 |
cataatttaataagtaggatgtttctttttcaaagaagtcagaaaaggccaaaatctatcggaacaattaggtacctttacattcattgtaggatccgta |
54314765 |
T |
 |
| Q |
123 |
tgcatttatagcttccactgattacaagatgattattaaaggactctatttggattgtttttagatgtttcttgtgttgcaagatatttcttagctttct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54314764 |
tgcatttatagcttccactgattacaagatgattattaaaggactctatttggattgtttttagatgtttcttgtgttgcaagatatttcttagctttct |
54314665 |
T |
 |
| Q |
223 |
aattctgattttggtgtcgtaatgtgtactgagttgatgccctcaataccatgtttttgtgttgatgtgtacttgcagtgatattttacggtacttgatt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54314664 |
aattctgattttggtgtcgtaatgtgtactgagttgatgccctcaataccatgtttttgtgttgatgtgtacttgcagtgatattttacggtacctgatt |
54314565 |
T |
 |
| Q |
323 |
acagctgatattttatgttttgttctcttctatttgtaggttttcaatattcttcg |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54314564 |
acagctgatattttatgttttgttctcttctatttgtaggttttcaatatttttcg |
54314509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 332 - 373
Target Start/End: Original strand, 50174148 - 50174189
Alignment:
| Q |
332 |
attttatgttttgttctcttctatttgtaggttttcaatatt |
373 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50174148 |
attttatgttttgttctcttctatttgcaggttttcaatatt |
50174189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University