View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5803_low_16 (Length: 340)

Name: NF5803_low_16
Description: NF5803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5803_low_16
NF5803_low_16
[»] chr5 (1 HSPs)
chr5 (9-80)||(15303112-15303179)


Alignment Details
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 9 - 80
Target Start/End: Complemental strand, 15303179 - 15303112
Alignment:
9 agcagagaacaccgttgttgaggtttgaatttgctcgattttggttctttgaattaataagtattttaaata 80  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||    
15303179 agcagaaaacaccgttgttgaggtttgaatttgctcgattttggttctttg----aataagtattttaaata 15303112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University