View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5804-Insertion-4 (Length: 320)
Name: NF5804-Insertion-4
Description: NF5804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5804-Insertion-4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 9 - 319
Target Start/End: Original strand, 21343674 - 21343984
Alignment:
| Q |
9 |
ataacagatgtaaaattatccatttagtgatttttaatggataagaaagcagaaagggtaccagttggtggagagaacagaacagaacaagtcagtaatc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21343674 |
ataacagatgtaaaattatccatttagtgatttttaaaggataagaaagcagaaagggtaccagttggtggagagaacagaacagaacaagtcagttatc |
21343773 |
T |
 |
| Q |
109 |
taaatggatgtagttgtacagcgcccaatatcacttcactgcttacctcaaagtgagattttaatttattcctaaccaattttcatccttcatgtacttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21343774 |
taaatggatgtagttgtacagcgcccaatatcacttcactgcttacctcaaagtgagattttaatttattcctaaccaattttcatccttcatgtacttg |
21343873 |
T |
 |
| Q |
209 |
cagttattatatttatatgctaactaaaatttcataaagcttagtagttagttttggtgtgcatgcaatgtggtttttagtttttactgggtggttcttc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21343874 |
cagttattatatttatatgctaactaaaatttcataaagcttagtagttagttttggtgtgcatgcaatgtggtttttagtttttactgggtggttcttc |
21343973 |
T |
 |
| Q |
309 |
agtttggtgga |
319 |
Q |
| |
|
||||||||||| |
|
|
| T |
21343974 |
agtttggtgga |
21343984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University