View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5804_low_5 (Length: 245)
Name: NF5804_low_5
Description: NF5804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5804_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 13454373 - 13454605
Alignment:
| Q |
1 |
gatagttcgtagtgccccattcagtcttcgccttatgaatgtccgattgacatattccacaatacaactctcttaatgctacgtctttttcgcatatttc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13454373 |
gatagttcgtagtgccccattcattcttcgccttatgaaggtccgagtgacatattccacaatacaacactcttaatgctacgtctttttcgcatatttc |
13454472 |
T |
 |
| Q |
101 |
cctgaaaatttaacgtactaaattagatttaattatgataaaaacttcct--tctctcnnnnnnnnnnnnnnnnnacaagatcaaacttccttcttagca |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
13454473 |
cctgaaaatttaacgtactaaattagattgaattatgataaaaacttccttctctctctctttttttttttttttacaagatcaaacttccttcttagca |
13454572 |
T |
 |
| Q |
199 |
ttctattttatgatttttattattgttattgat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13454573 |
ttctattttatgatttttattattgttattgat |
13454605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University