View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808-Insertion-4 (Length: 531)
Name: NF5808-Insertion-4
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808-Insertion-4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 479; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 479; E-Value: 0
Query Start/End: Original strand, 9 - 531
Target Start/End: Original strand, 14539098 - 14539620
Alignment:
| Q |
9 |
cctggtgcactgcttctcagagctggtgttatccatagaagctattgaagttgaagtgaaaccagtcataccaaattccctatcgtacgtatcaagtgtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539098 |
cctggtgcactgcttctcagagctggtgttatccatagaagctattgaagttgaagtgaaaccagtcataccaaattccctatcgtacgtatcaagtgtc |
14539197 |
T |
 |
| Q |
109 |
acttgttggctctgcctcccaaaggttgcactgccactcatactttggtccctaccgctccccgccacgtgtgccaccctcccatgctttgccgctgacg |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14539198 |
acttgctggctctgcctcccaaaggttgcactgccactcatactttggtccctaccgctccccgccacgtgtgccaccctcccacgctttgccgctgacg |
14539297 |
T |
 |
| Q |
209 |
cagcaaggatacctccttcgtcctgcgttgcggccacgacagcactgcaggaacccacaggtgtatggccgccaaccatgcatgatccaatccctgatct |
308 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539298 |
cagcaaggatacctccttcgtcttgcgttgcggccacgacagcactgcaggatcccacgggtgtatggccgccaaccatgcatgatccaatccctgatct |
14539397 |
T |
 |
| Q |
309 |
agggactggatccattgcatgggttctctgctccttagtagtattggagcacggaaccaacgcgtccacagccatgccgttggaggcggctgtggcagct |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14539398 |
agggactggatccattgcatgggttctctgctccttagtagtattggagcagggaaccaacgcatccacagccatgccgttggaggcggctgtggcggct |
14539497 |
T |
 |
| Q |
409 |
gcgatggctgcagcacgttgtgggtcaagccatgggactaacatgtttccataaacaccaccacccgcgagaaagggtgattttccgcggtgcggaaagc |
508 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14539498 |
gcgatggctgccgctcgttgtgggtcaagccatgggactaacatgtttccataaacaccaccaccggcgagaaagggtgattttccgcggtgcggaaagc |
14539597 |
T |
 |
| Q |
509 |
ttgtggcttggttcactatagac |
531 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14539598 |
ttgtggcttggttcactatagac |
14539620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University