View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808-Insertion-7 (Length: 290)
Name: NF5808-Insertion-7
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808-Insertion-7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 15 - 290
Target Start/End: Complemental strand, 51745381 - 51745106
Alignment:
| Q |
15 |
cctctacaatgccaccactgacgttggtgttgccactggggcacaacctcttgatgtggctgtgccatatccatgtctctccctctccccgtcgtcgctt |
114 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51745381 |
cctcaacaatgccaccactaacgttggtgttgccactggctcgcaacctcttgatgtcactgtgccatatccatgtctctccctctccccgtcgtcgctt |
51745282 |
T |
 |
| Q |
115 |
caattttgtcatagttgcatacccgaggtcgtcacctcttcttcctacattttctttttctccaacggtatcatcttcacacagtttgggcacagtcccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51745281 |
caattttgtcatagttgcatacccgaggtcgtcacctcttcttcctacattttctttttctccaacggtatcatcttcacacagtttgggcacagtcccc |
51745182 |
T |
 |
| Q |
215 |
ttctccatgttcccccaatttcatcagttttcgtgtctacactagaataatgaacggagagtattaggttgatttc |
290 |
Q |
| |
|
||||| |||||||||||||||||||||||| || ||||||||||||||| ||||| | |||| |||||||||||| |
|
|
| T |
51745181 |
ttctctatgttcccccaatttcatcagtttccgagtctacactagaatagtgaacatatagtagtaggttgatttc |
51745106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University