View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5808_high_24 (Length: 250)

Name: NF5808_high_24
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5808_high_24
NF5808_high_24
[»] chr7 (1 HSPs)
chr7 (18-200)||(37983039-37983221)


Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 37983039 - 37983221
Alignment:
18 ataggatgtctaatgcaacatgatgttgaaacaaagaattgattttaccataagtcactcgccacattattatgaacgtcatggcattgtggggaaggca 117  Q
    |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||  ||||||||||||||||||||| ||| |||||||    
37983039 atagaatgtctaatgcaacatgatgttgaaacaaataattgattttaccataagtcactcaccaccatattatgaacgtcatggcattatggcgaaggca 37983138  T
118 cccattaccaacttagaatttcttttttaaaaaccatatttgtctattttgaggaaaatacagatatcaagaaatcgaataaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||| ||||||    
37983139 cccattaccaacttagaatttcttttttaaaaaccatatttgtccattttgaggaaattacacatatcaagaaatcaaataaa 37983221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University