View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808_high_31 (Length: 214)
Name: NF5808_high_31
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 63 - 199
Target Start/End: Original strand, 22199847 - 22199983
Alignment:
| Q |
63 |
tagtattttttatgtatatgattctattacgaatgaaccatatttaattatagagaaatacaagagttcaggaatgaattaataggccatctgtttgatc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22199847 |
tagtattttttatgtatatgattctattacgaatgaaccaaatttaattatagagaaatacaagagttcgggaatgaattaataggccatctgtttgatc |
22199946 |
T |
 |
| Q |
163 |
caatgactaatgggcatccatccatcatatattcatc |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22199947 |
caatgactaatgggcatccatccataatatattcatc |
22199983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University