View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808_low_12 (Length: 385)
Name: NF5808_low_12
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 44095891 - 44095645
Alignment:
| Q |
1 |
atgtatgaatgataatattttttgcaagtataatgtgacattgcatgcgcttatctctatctcgcgtactttttatcatttaaaatttactcatgtttta |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44095891 |
atgtatgaatgatgatattttttgcaagtataatgtgacattgcatgtgcttatctctatctcgcgtactttttatcatttaaaatttactcatgtttta |
44095792 |
T |
 |
| Q |
101 |
aaaatcgaaaatgctatgaatattca-ttaaattactcacgttttaaaatttccactaaagcatggattgtaaccattatgtgcttcttaaaaccaacaa |
199 |
Q |
| |
|
||||||||||||||||| |||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44095791 |
aaaatcgaaaatgctatcaatattcactaaaattactcacgttttaaaatttccactaaagcatggattgtaa-------atgcttcttaaaaccaacaa |
44095699 |
T |
 |
| Q |
200 |
gctgtcttcttgaaaattcacgacaaacaattcgtatgaatatcgttgctcttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
44095698 |
gctgtcttcttgaaaattcacgacaaacaattcatatgaatatcattgctcttt |
44095645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 298 - 370
Target Start/End: Complemental strand, 44095600 - 44095527
Alignment:
| Q |
298 |
tttgatcttcatacatcatttctcctaaaaaagataac-gtaaattatgttaagaaatctttaaccattctttt |
370 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44095600 |
tttgatcttcatacattatttctcctaaaaaagataacagtaaattatgttaagaaatctctaaccattctttt |
44095527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University