View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808_low_18 (Length: 313)
Name: NF5808_low_18
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 302
Target Start/End: Complemental strand, 51745387 - 51745104
Alignment:
| Q |
19 |
gttgtacctcaacaatgccaccactgacgttggtgttgccactggctcacaacctcttgatgtagctgtgccatatccatgtctctccctctccccgtcg |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51745387 |
gttgtacctcaacaatgccaccactaacgttggtgttgccactggctcgcaacctcttgatgtcactgtgccatatccatgtctctccctctccccgtcg |
51745288 |
T |
 |
| Q |
119 |
tcgcttcaattttgtcatagttgcatacccgaggtcgtcacctcttcttcctacattttctttttctccaacggtatcatcttcacacagtttgggcaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51745287 |
tcgcttcaattttgtcatagttgcatacccgaggtcgtcacctcttcttcctacattttctttttctccaacggtatcatcttcacacagtttgggcaca |
51745188 |
T |
 |
| Q |
219 |
gtccccttctccatgttcccccaatttcatcagttttcgggtctacactagaatagtgaacatagagtattaggttgatttcat |
302 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
51745187 |
gtccccttctctatgttcccccaatttcatcagtttccgagtctacactagaatagtgaacatatagtagtaggttgatttcat |
51745104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University