View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808_low_21 (Length: 281)
Name: NF5808_low_21
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 271
Target Start/End: Complemental strand, 11059907 - 11059652
Alignment:
| Q |
16 |
aaaacatccatcactctattcatgctatataacaaaatactataggcactaggcagtataaaataacaaccataaattggatcataagcactatgttatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11059907 |
aaaacatccatcactctattcatgctatataacataatactataggcactaggcagtataaaataacaaccataaattggatcataagcactatgttatt |
11059808 |
T |
 |
| Q |
116 |
ttgaaactgattctactatgcataccacgatttgcagtagcctgtgcctcagccataaactcttcataagaagcctgaaaaaacaaccatatatattagt |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11059807 |
ttgaaattgattctactatgcataccacgatttgcagtagcctgtgcctcagccataaactcttcataagaagcctgaaaaaacaaccatatatattagt |
11059708 |
T |
 |
| Q |
216 |
ctcttaaatcttaatcaagttttttgaatgataatgaaggattaataaccttcatc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11059707 |
ctcttaaatcttaatcaagttttttgaatgataatgaaggattaataaccttcatc |
11059652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University