View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808_low_25 (Length: 250)
Name: NF5808_low_25
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 37983039 - 37983221
Alignment:
| Q |
18 |
ataggatgtctaatgcaacatgatgttgaaacaaagaattgattttaccataagtcactcgccacattattatgaacgtcatggcattgtggggaaggca |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||| ||||||| |
|
|
| T |
37983039 |
atagaatgtctaatgcaacatgatgttgaaacaaataattgattttaccataagtcactcaccaccatattatgaacgtcatggcattatggcgaaggca |
37983138 |
T |
 |
| Q |
118 |
cccattaccaacttagaatttcttttttaaaaaccatatttgtctattttgaggaaaatacagatatcaagaaatcgaataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||| |||||| |
|
|
| T |
37983139 |
cccattaccaacttagaatttcttttttaaaaaccatatttgtccattttgaggaaattacacatatcaagaaatcaaataaa |
37983221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University