View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808_low_26 (Length: 244)
Name: NF5808_low_26
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 130659 - 130874
Alignment:
| Q |
1 |
gatttgtttgttttctaaaattattttaattcttcctattatcatcatgccatgaatggaagattaatgtatttaacaattgtgataaagaaaatgaaag |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
130659 |
gattcgtttgttttctaaaattattttaattcttcctattatcatcatgccatgaatggaagattaatgtatttaacaattgtgataaagaaaatgaaag |
130758 |
T |
 |
| Q |
101 |
accaataaaggagagttcattttttaatatattgaaaaaagtgttgatgattgaagggaacatgtgatcccctttgaagaagggttgagggttgaacaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
130759 |
accaataaaggagagttcattttttaatatattgaaaatagtgttgatgattgaagggaacatgtgatcccctttgaaga-------agggttgaacaag |
130851 |
T |
 |
| Q |
201 |
gtatgaacattgatgattgtagg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
130852 |
gtatgaacattgatgattgtagg |
130874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University