View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808_low_27 (Length: 238)
Name: NF5808_low_27
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808_low_27 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 33249027 - 33249246
Alignment:
| Q |
18 |
agaaagaggggaga--gattaaaaactggcaggtcctacataaatattctttctcttcatgggtgagaagaaacgttaggagttgttgttattttgagtg |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33249027 |
agaaagaggggagagagattaaaaactggcaggtcctacataaatattccttctcttcatgggtgagaagaaacgttagga---gttgttattttgagtg |
33249123 |
T |
 |
| Q |
116 |
tttcccaattatacccttgcctacattaatagtaacacgggtcatannnnnnnnnngagaaagaccaaataacacgannnnnnnggtatgacc-tataac |
214 |
Q |
| |
|
||| |||||||||||||||| |||||||| | ||| | |||||||| |||||||||||||||||||| |||||||| ||| || |
|
|
| T |
33249124 |
ttttccaattatacccttgcttacattaacaataatatgggtcatatttttttttt-agaaagaccaaataacacgattttttttgtatgaccgtatgac |
33249222 |
T |
 |
| Q |
215 |
aacataggatttgataaaaatagt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33249223 |
aacataggatttgataaaaatagt |
33249246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 61 - 141
Target Start/End: Complemental strand, 2836918 - 2836838
Alignment:
| Q |
61 |
attctttctcttcatgggtgagaagaaacgttaggagttgttgttattttgagtgtttcccaattatacccttgcctacat |
141 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| ||||||||||||| | |||| ||||||||||||||| ||||| |
|
|
| T |
2836918 |
attctttctcttcatgggtgtgaagaaacgggaggagctgttgttattttgggaatttctcaattatacccttgcttacat |
2836838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 141
Target Start/End: Complemental strand, 43148242 - 43148166
Alignment:
| Q |
65 |
tttctcttcatgggtgagaagaaacgttaggagttgttgttattttgagtgtttcccaattatacccttgcctacat |
141 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||||| |||||||| ||| | |||| ||||||||||||||| ||||| |
|
|
| T |
43148242 |
tttctcttcatgagtgtgaagaaacgggaggaggagttgttatcttgggcatttctcaattatacccttgcttacat |
43148166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University