View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5808_low_30 (Length: 221)
Name: NF5808_low_30
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5808_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 19 - 131
Target Start/End: Original strand, 10491639 - 10491751
Alignment:
| Q |
19 |
attcttagcaatatcactatacgtactcttgatggttaacattctatatcttttgaatcgtgggtgaagttgacagtgagcatttttcgacaatattaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10491639 |
attcttagcaatatcactatacgtactcttgatggttaacattctatatcttttgaatcgtgggtgaagttgacgatgagcatttttcgacaatattaat |
10491738 |
T |
|
| Q |
119 |
aacatagaagtgc |
131 |
Q |
| |
|
| |||||||||| |
|
|
| T |
10491739 |
attatagaagtgc |
10491751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 10491781 - 10491820
Alignment:
| Q |
162 |
gcatacaaaacaatagcatattgaatcatcatgaataagt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10491781 |
gcatacaaaacaatagcatattgaatcatcatgaataagt |
10491820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University