View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5809-Insertion-3 (Length: 324)
Name: NF5809-Insertion-3
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5809-Insertion-3 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 9 - 324
Target Start/End: Original strand, 19631164 - 19631476
Alignment:
| Q |
9 |
ttagtgggagatgaaccgttccattcttctaatgttaataatgatgtcttgttggatgtnnnnnnnnnnnnnnnnnnnnntgaaactgaatccatgatga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19631164 |
ttagtgggagatgaaccgttccattcttctaatgttaataatgatgtcttgttggatg---cagaagaagaagaagaagatgaaactgaatccatgatga |
19631260 |
T |
 |
| Q |
109 |
cctgaccagatcatgaactgaagtgcataacctttgatgacttcgtaggtagacagattttgcaactcgtgtcgtgtgtttacaagcgtatgtcgcacgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19631261 |
cctgaccagatcatgaactgaagtgcataacctttgatgacttcgtaggtagacaggttttgcaactcgtgtcgtgtgtttacaagcgtatgtggcacgt |
19631360 |
T |
 |
| Q |
209 |
gagtccccctgttttaaccaatcagggattttgatctcctatttgttaaggaaaattaatttgataaatttttgtcatcatatttgtttttgggatagct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19631361 |
gagtccccctgttttaaccaatcagggattttgatctcctatttgttatggaaaattaatttgataaatttttgtcatcatatttgtttttgggatagct |
19631460 |
T |
 |
| Q |
309 |
tatgtttttactcttt |
324 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
19631461 |
tatgtttttactcttt |
19631476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University