View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5809_high_12 (Length: 317)
Name: NF5809_high_12
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5809_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 14 - 87
Target Start/End: Original strand, 13179499 - 13179572
Alignment:
| Q |
14 |
cacagatgacactgtttatgttactgtcaaatcggtaatgcattttgttggaactgtttttgcaattaattata |
87 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13179499 |
cacagatgacactgtttatgttgctgtcaaatcggtaatgcattttgttggaactgtttttgcaattaattata |
13179572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 14 - 84
Target Start/End: Complemental strand, 32373750 - 32373680
Alignment:
| Q |
14 |
cacagatgacactgtttatgttactgtcaaatcggtaatgcattttgttggaactgtttttgcaattaatt |
84 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373750 |
cacagatgacactgtttatgatgctgtgaaatcggtaatgcattttgttggaactgtttttgcaattaatt |
32373680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 14 - 84
Target Start/End: Complemental strand, 32409786 - 32409716
Alignment:
| Q |
14 |
cacagatgacactgtttatgttactgtcaaatcggtaatgcattttgttggaactgtttttgcaattaatt |
84 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32409786 |
cacagatgacactgtttatgatgctgtcaaatcggtaatgcattttgttggaactggttttgcaattaatt |
32409716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University