View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5809_high_3 (Length: 491)
Name: NF5809_high_3
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5809_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 422; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 35 - 484
Target Start/End: Complemental strand, 53128607 - 53128158
Alignment:
| Q |
35 |
tggcgtggcctttgaagtcgcctcctttgcaactagtatccatagttgggattgtgatgtttttgctatttgttccatcttatataaacttcaagcaaac |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53128607 |
tggcgtggcctttgaagtcgcctcctttgcaactagtatctatagttgggattgtgatgtttttgctatttgttccatcttatataaacttcaaacaaac |
53128508 |
T |
 |
| Q |
135 |
agtgcacaaagccaacatcagtttccacttctttctcttgattttgccactcctgttgatttttattgcatacttcatctccaaatgcgggccacggttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53128507 |
agtgcacaaagccaacatcagtttccacttctttctcttgattttgccactcctgttgatttttattgcatacttcatctccaaatgcgggccacggttt |
53128408 |
T |
 |
| Q |
235 |
gtaattcaggtggatttctttggtcgacggttaatacaatcacgcacacaaacagaaggaggaggatcgtcaccttggggcgtcgcggcgctggtggtgt |
334 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53128407 |
gtaattccggtggatttctttggtcgacggttaatacaatcacgcgcacaaacagaaggaggaggatcgtcaccttggggcgttgcggcgctggtggtgt |
53128308 |
T |
 |
| Q |
335 |
tgcttttggttttggcttccaaaatctccagcttcaggtctatgtggtcgccactcatttggagaccccattagttgatgtatcgtatcatttgtaagtc |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53128307 |
tgcttttggttttggcttccaaaatctccagcttcaggtctatgtggtcgccactcatttggagaccccattagttgatgtatcatatcatttgtaagtc |
53128208 |
T |
 |
| Q |
435 |
ataacatctatgaaatagaaatttgtcacctatcttacgcatctgtgctc |
484 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53128207 |
ataacatctatgaaatagaaatttgtcacctatcttacgcatctgggctc |
53128158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University