View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5809_high_8 (Length: 350)
Name: NF5809_high_8
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5809_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 346
Target Start/End: Original strand, 19631164 - 19631488
Alignment:
| Q |
19 |
ttagtgggagatgaaccgttccattcttctaatgttaataatgatgtcttgttggatgtnnnnnnnnnnnnnnnnnnnnntgaaactgaatccatgatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19631164 |
ttagtgggagatgaaccgttccattcttctaatgttaataatgatgtcttgttggatg---cagaagaagaagaagaagatgaaactgaatccatgatga |
19631260 |
T |
|
| Q |
119 |
cctgaccagatcatgaactgaagtgcataacctttgatgacttcgtaggtagacagattttgcaactcgtgtcgtgtgtttacaagcgtatgtcgcacgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19631261 |
cctgaccagatcatgaactgaagtgcataacctttgatgacttcgtaggtagacaggttttgcaactcgtgtcgtgtgtttacaagcgtatgtggcacgt |
19631360 |
T |
|
| Q |
219 |
gagtccccctgttttaaccaatcagggattttgatctcctatttgttaaggaaaattaatttgataaatttttgtcatcatatttgtttttgggatagct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19631361 |
gagtccccctgttttaaccaatcagggattttgatctcctatttgttatggaaaattaatttgataaatttttgtcatcatatttgtttttgggatagct |
19631460 |
T |
|
| Q |
319 |
tatgtttttactctttttcttctctctc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
19631461 |
tatgtttttactctttttcttctctctc |
19631488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University