View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5809_low_10 (Length: 326)
Name: NF5809_low_10
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5809_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 38 - 308
Target Start/End: Complemental strand, 7724114 - 7723844
Alignment:
| Q |
38 |
catcatgtgacgataccatagaaccatcgcaatcaaaaacatcttctacatatcattatcattggtcttgaccgtcctagctgctttactaaatctatta |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724114 |
catcatgtgacgataccatagaaccatcgcaatcaaaaacatcttctacatatcattatcattggtcttgaccgtcctagctgctttactaaatctatta |
7724015 |
T |
 |
| Q |
138 |
ctattttaacattattattaatatttttcatgaacgaggcttgttctatcagagtctccaagagagaaatggaatgccattttcagaatcatgattggtt |
237 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724014 |
ctattataacattattattaatatttttcatgaacgaggcttgttctatcagagtctccaagagagaaatggaatgccattttcagaatcatgattggtt |
7723915 |
T |
 |
| Q |
238 |
tcatcaatgaaacggaactcgttagtcattgctggagagaaacactgcatcttctggttctgtggttgtac |
308 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723914 |
tcatcaatgaaacggaactcgttagtaattgccggagagaaacactgcatcttctggttctgtggttgtac |
7723844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University