View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5809_low_22 (Length: 239)
Name: NF5809_low_22
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5809_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 9727410 - 9727544
Alignment:
| Q |
1 |
tagacctccaatcgagatcggacggtacagatctcttgatgtcgtgaacgcgtgcagtcaatgacagtagggaatccgggttcgtattattaggaattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
9727410 |
tagacctccaatcgagatcggacggtacagatctcttgattgcgtgaacgcgtgcagtcaatgaccgtagggaatccgggtttgtattattaggaattct |
9727509 |
T |
 |
| Q |
101 |
ataagaatttgtttaaaactgatttgagtttattt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9727510 |
ataagaatttgtttaaaactgatttgagtttattt |
9727544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 136 - 222
Target Start/End: Original strand, 9727610 - 9727696
Alignment:
| Q |
136 |
acagggaatagatttaagtcaatgttgagttgagaacatttgtcatacctaaccttttcaaatttcattcccaaataaacatcacat |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9727610 |
acaggtaatagatttaagtcaatgttgagttgagaacatttgtcatacctaaccttttcaaatttcattcccaaataaacatcacat |
9727696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University