View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811-Insertion-15 (Length: 82)
Name: NF5811-Insertion-15
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811-Insertion-15 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 9 - 82
Target Start/End: Original strand, 37081344 - 37081417
Alignment:
| Q |
9 |
aacaccactttgacgatgaatccccgattttatagagctcacaagctttgaaaatcttatccccaccaattctc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37081344 |
aacaccactttgacgatgaatccccgattttatagagctcacaagctttgaaaatcttatccccaccaattctc |
37081417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 5e-25
Query Start/End: Original strand, 9 - 82
Target Start/End: Original strand, 37071503 - 37071576
Alignment:
| Q |
9 |
aacaccactttgacgatgaatccccgattttatagagctcacaagctttgaaaatcttatccccaccaattctc |
82 |
Q |
| |
|
|||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37071503 |
aacaccacttcgacgatgaatccccgatcttgtagagctcacaagctttgaaaatcttatccccgccaattctc |
37071576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University