View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811-Insertion-6 (Length: 566)
Name: NF5811-Insertion-6
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811-Insertion-6 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 268 - 566
Target Start/End: Complemental strand, 18217407 - 18217109
Alignment:
| Q |
268 |
tcacatttttcttcttggtgacaaaatccaaaggagcatcatcattattcccaaaatctttggctccattcaagctaagtctcccttttgaattcagatt |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18217407 |
tcacatttttcttcttggtgacaaaatccaaaggggcatcatcattattcccaaaatctttggctccattcaagctaagtctcccttttgaattcagatt |
18217308 |
T |
 |
| Q |
368 |
agatggattaaaatcatgtggagcaatcattcccgccgttacagagggccccacttgccaaacatggttaatggcggtaacatcaaccggaaccttaacg |
467 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18217307 |
agatggattaaaatcatgtggagcaatcattcccgccgttacagagggccccacttgccaaacatggttaatggcggtaacattaaccggaaccttaacg |
18217208 |
T |
 |
| Q |
468 |
gtagcaaaaatcttcattaaaccaccagcttcctcggctttcatatcccaaacatcaaaagaaagcttcccaggaataaaaaccttgtaagatttaagg |
566 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18217207 |
gtagcaaaaatcttcattaaaccaccatcttcctcggctttcatatcccaaacatcaaaagaaagcttcccaggaataaaaaccttgtaagatttaagg |
18217109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 176; E-Value: 2e-94
Query Start/End: Original strand, 9 - 184
Target Start/End: Complemental strand, 18217666 - 18217491
Alignment:
| Q |
9 |
ccccaaccagcaactccgataatataagcagatagttggcaaccaatatgaatatagaaccaagccggatccgccgatggaaaaattttcatatatcttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18217666 |
ccccaaccagcaactccgataatataagcagatagttggcaaccaatatgaatatagaaccaagccggatccgccgatggaaaaattttcatatatcttg |
18217567 |
T |
 |
| Q |
109 |
ctatgataactccaaggggaaacaaaataccccaactcactatatttagtactccatgaatctgtcatcattcaac |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18217566 |
ctatgataactccaaggggaaacaaaataccccaactcactatatttagtactccatgaatctgtcatcattcaac |
18217491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University