View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_high_43 (Length: 307)
Name: NF5811_high_43
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 157 - 294
Target Start/End: Complemental strand, 36142414 - 36142277
Alignment:
| Q |
157 |
tcctccatgatgacgtggatgcatatttaccttagttttttcctatttgatgacgtggaggtttactgtttcattgctttgtgattgagaattagattga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36142414 |
tcctccatgatgacgtggatgcatatttaccttagttttttcctatttgatgacgtggaggtttactgtttcattgctttgtgattgagaattagattga |
36142315 |
T |
 |
| Q |
257 |
ttgactgaaaattcaatttggtcctcgcaattttctct |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36142314 |
ttgactgaaaattcaatttggtcctcgcaattttctct |
36142277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 36142570 - 36142453
Alignment:
| Q |
1 |
acaagtggtggttgggggaggattgatcgagacgacgccgttgaagctatgctccggtatgctgattccggcttatctaccttcgacatggctgatcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36142570 |
acaagtggtggttgggggaggattgatcgagacgacgccgttgaagctatgctccggtatgctgattccggcttatctaccttcgacatggctgatcact |
36142471 |
T |
 |
| Q |
101 |
gtatgtaacttagtccac |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36142470 |
gtatgtaacttagtccac |
36142453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University