View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_high_67 (Length: 249)
Name: NF5811_high_67
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_high_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 1458705 - 1458887
Alignment:
| Q |
1 |
tgccgtcacataccgttttctttctttt--gtcaccgatgaccaaattatatgaaagtcatactaagaaatcttgttagggtttatatttgtttgtttg- |
97 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||| |||| ||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
1458705 |
tgccgtcacatgccgttttctttctttgtcgtcaccgatgatcaaactatatgaaagtcatactaaaaactcttgttagggtttatatttgtttgtttgt |
1458804 |
T |
 |
| Q |
98 |
tttttaattggtagtggtaagaactcttgttagggtttatagttgtttgtttgttttttaattggcggtgggtacataaaattttagg |
185 |
Q |
| |
|
|||||||||||||| | ||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
1458805 |
tttttaattggtagcgttaagaactctt-----ggtttatatttgtttgtttgttttttaattggcggtggttacataagattttagg |
1458887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University