View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_high_71 (Length: 239)
Name: NF5811_high_71
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_high_71 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 76 - 219
Target Start/End: Original strand, 33793357 - 33793500
Alignment:
| Q |
76 |
catcaaacacttcaaattcaattagttatgttatccggtatatataaattcatcaactcttatctaacttgtgtattatccattatgatttttaccaaaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33793357 |
catcaaacacttcaaattcaattagttatgttatccgatatatataaattcatcaactcttatctaacttgtgtattatccattatgatttttaccaaaa |
33793456 |
T |
 |
| Q |
176 |
agagtcaatatcaaagatcataaaaagcaacaaactatgactta |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33793457 |
agagtcaatatcaaagatcataaaaaacaacaaactatgactta |
33793500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University