View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_high_75 (Length: 236)
Name: NF5811_high_75
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_high_75 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 31937661 - 31937881
Alignment:
| Q |
1 |
tttcatgtcctaacaaaacttttgcagctagcaaaatgagttaatacatgagcaaagagttcacatgtcatcctcaagctatcaatcaaattttgcaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31937661 |
tttcatgtcctaacaaaacttttgcagctagcaaaatgagtcaatacatgagcaaagagttcacatgtcatcctcaagctatcaatcaaattttgcaata |
31937760 |
T |
|
| Q |
101 |
cctaaagacctaacaaggtttgggtttgatgttccattctgcgtcatctttgaaagtgacacaatacgtggatgcatactggggaggttgtaaacaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31937761 |
cctaaagacctaacaaggtttgggtttgatgttccattctgcgtcatctttgaaagtgacacaatacgtggatgcatactggggaggttgtaaacaacca |
31937860 |
T |
|
| Q |
201 |
taagatgaacaacatgatatt |
221 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
31937861 |
taagatgaaccacatgatatt |
31937881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University