View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_high_78 (Length: 230)
Name: NF5811_high_78
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_high_78 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 10 - 204
Target Start/End: Complemental strand, 22869239 - 22869045
Alignment:
| Q |
10 |
gaaccctttgctacacaatctttgattcttgttgctgaccccatccagcagtaaaaggctttgattgtcactgttgttaaaaatcataatactgaactat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22869239 |
gaaccctttgctacacaatctttgattcttgttgctgaccccatccagcagtaaaaggctttgattgtcactgttgttaaaactcataatactgaactat |
22869140 |
T |
|
| Q |
110 |
ataatttattcctgttgtaatattgaattgaaatgtatacactctagacattggtttttctgtttgcttggagctttacatttatctgctctctt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||| |
|
|
| T |
22869139 |
ataatttattcctgttgtaatattgaattgaaatgtatacactctagacattggtttttctgtttggttggagctattcatttatctgctctctt |
22869045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 28 - 206
Target Start/End: Complemental strand, 22837862 - 22837684
Alignment:
| Q |
28 |
tctttgattcttgttgctgaccccatccagcagtaaaaggctttgattgtcactgttgttaaaaatcataatactgaactatataatttattcctgttgt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |||||||||||||||| |
|
|
| T |
22837862 |
tctttgattcttgttgctgaccccatccagcagtaaaaggctttgattgtcactgttgttaaaactgataatactgaactatagaatttattcctgttgt |
22837763 |
T |
|
| Q |
128 |
aatattgaattgaaatgtatacactctagacattggtttttctgtttgcttggagctttacatttatctgctctcttct |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| | |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
22837762 |
aatattgaattgaaatgtatacagtctagacattggttttgcagtttgcttggagctgtacatttatttgctctcttct |
22837684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University