View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_high_87 (Length: 219)
Name: NF5811_high_87
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_high_87 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 25684917 - 25685123
Alignment:
| Q |
13 |
aatataaaatttcaggtttcggcaattacatgtaagcaagtctcatcataatcatttgcaggtttttcttctataaatttaattgctctccatgtgtttt |
112 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25684917 |
aatacaaaatttcaggtttcggcaattgcatgtaagcaagtctaatcataatcatttgcaggtttttcttctataaatttaattgctcaccatgtgtttt |
25685016 |
T |
|
| Q |
113 |
gattttattagaccgtcagatcaaagaaactatgacacgatgagaaataaacaagtatataaatacctggagtaagatgacataagaatatatagttgtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25685017 |
gattttattagaccgtcagatcaaagaaactatgacacgatgagaaataaacaagtatataaatacctggagtaagatgacataagaatatatagttgtt |
25685116 |
T |
|
| Q |
213 |
tgtatta |
219 |
Q |
| |
|
||||||| |
|
|
| T |
25685117 |
tgtatta |
25685123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University