View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_24 (Length: 401)
Name: NF5811_low_24
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 25720690 - 25720870
Alignment:
| Q |
13 |
gagacaaagcagaaggatagagaaatggatttaccttaacggaagaaaattattggtgctatgagatttaactgccatgtaacggatgaagaagaacttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25720690 |
gagacaaagcagaaggatagagaaatggatttaccttaacggaagaaaattattggtgctatgagatttaactgccatgtaacggatgaagaagaatttg |
25720789 |
T |
 |
| Q |
113 |
aagagaaaattgaagttgcgtcactgtaaaagatagatagaagagagnnnnnnngtgaaatagagaaggaagaggttgcgt |
193 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25720790 |
aagagaaaattgaagttgcgtcgctgtaaaagatagatagaagagagaaaaaaagtgaaatagagaaggaagaggttgcgt |
25720870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 235 - 370
Target Start/End: Original strand, 25720912 - 25721046
Alignment:
| Q |
235 |
gatgacatagcatgaggtgagtactttatctgaatacgtggataactcacaacaacaccaatctagttcatgtaatcattttgcaaagttacaagattat |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25720912 |
gatgacatagcatgaggtgagtactttatctgaatacgtggataactcacaacaacaccaatctagttcatgtaatcattttgcaaagttacaagattat |
25721011 |
T |
 |
| Q |
335 |
gattatgattataaaacttaaatgcagttttgatca |
370 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
25721012 |
g-ttatgattataaaacttaaatgcacttttgatca |
25721046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University