View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_28 (Length: 367)
Name: NF5811_low_28
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 9e-86; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 157 - 349
Target Start/End: Complemental strand, 7858436 - 7858244
Alignment:
| Q |
157 |
ataccaaatcaaatatactgtcatcgcatgttcttatgtcaataaatgaataatacatttttggaatagtgaaagacccatcatgattaaacttctacac |
256 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7858436 |
ataccaaatcaaatatactgtcatcacatattcttatgtcaataaatgaataatacatttttggaatagtgaaagacccatcatgattaaacttctacac |
7858337 |
T |
 |
| Q |
257 |
acctgtgagcaagatatggctttgcaaatgaaaaaattgccggaacagagcctctatgtataccaaactttcagataagtagctatagaacaa |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
7858336 |
acctgtgagcaagatatggctttgcaaatgaaaatttttccggaatagagcctctatgtataccaaattttcagataagtagctataaaacaa |
7858244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 7858575 - 7858523
Alignment:
| Q |
1 |
attggtaaagctctacttatgcaaccatcgacaacttaaaatgagtaagcaca |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7858575 |
attggtaaagctctacttatgcaaccatcgacaacttaaaatgagtaagcaca |
7858523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 96 - 126
Target Start/End: Complemental strand, 7858497 - 7858467
Alignment:
| Q |
96 |
gctaaatcaaacatgatcaaaatatattgtc |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7858497 |
gctaaatcaaacatgatcaaaatatattgtc |
7858467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University