View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_32 (Length: 355)
Name: NF5811_low_32
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 67 - 345
Target Start/End: Complemental strand, 36568338 - 36568060
Alignment:
| Q |
67 |
aatcagtgattgtgatggaccaattcttgaccagacattatgttacgttgtgttgtgttgtgtgcaggatatttttgaatctatgggagattatgttgat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36568338 |
aatcagtgattgtgatggaccaattcttgaccagacattatgttacgttgtgttgtgttgtgtgcaggatatttttgaatctatgggagattatgttgat |
36568239 |
T |
 |
| Q |
167 |
ggtttgaaattttcaggaggttctgacagtttgatgccaaaagcatttatcaaacaagttattgatactgctcatcaccatgatgtttatgttagcactg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36568238 |
ggtttgaaattttcaggaggttctgacagtttgatgccaaaagcatttatcaaacaagttattgatactgctcatcaccatgatgtttatgttagcactg |
36568139 |
T |
 |
| Q |
267 |
gtgattgggctgaacatatcattcacaaaggtccttcaggattcaaagactatgtggaggtttcattttgccacctttg |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36568138 |
gtgattgggctgaacatatcattcacaaaggtccttcaggattcaaagactatgtggaggtttcattttgccacctttg |
36568060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 36568398 - 36568365
Alignment:
| Q |
1 |
ctctcttcaaccacaatgttcttcaggttcacca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36568398 |
ctctcttcaaccacaatgttcttcaggttcacca |
36568365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University