View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_59 (Length: 254)
Name: NF5811_low_59
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 50 - 131
Target Start/End: Original strand, 26272959 - 26273040
Alignment:
| Q |
50 |
aggtgtggtggttaaagtgatgaattttgattagtttagtgatgaagatgataatattttatgggtttagtgttgaagatgg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26272959 |
aggtgtggtggttaaagtgatgaattttgatgagtttagtgatgaaggtgataatattttatgggtttagtgttgaagatgg |
26273040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 50 - 131
Target Start/End: Complemental strand, 43711904 - 43711823
Alignment:
| Q |
50 |
aggtgtggtggttaaagtgatgaattttgattagtttagtgatgaagatgataatattttatgggtttagtgttgaagatgg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43711904 |
aggtgtggtggttaaagtgatgaattttgatgagtttagtgatgaatgtgataatattttatgggtttagtgttgaagatgg |
43711823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University