View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5811_low_67 (Length: 249)

Name: NF5811_low_67
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5811_low_67
NF5811_low_67
[»] chr1 (1 HSPs)
chr1 (1-185)||(1458705-1458887)


Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 1458705 - 1458887
Alignment:
1 tgccgtcacataccgttttctttctttt--gtcaccgatgaccaaattatatgaaagtcatactaagaaatcttgttagggtttatatttgtttgtttg- 97  Q
    ||||||||||| |||||||||||||||   ||||||||||| |||| ||||||||||||||||||| || |||||||||||||||||||||||||||||     
1458705 tgccgtcacatgccgttttctttctttgtcgtcaccgatgatcaaactatatgaaagtcatactaaaaactcttgttagggtttatatttgtttgtttgt 1458804  T
98 tttttaattggtagtggtaagaactcttgttagggtttatagttgtttgtttgttttttaattggcggtgggtacataaaattttagg 185  Q
    |||||||||||||| | |||||||||||     |||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||    
1458805 tttttaattggtagcgttaagaactctt-----ggtttatatttgtttgtttgttttttaattggcggtggttacataagattttagg 1458887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University