View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_70 (Length: 240)
Name: NF5811_low_70
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 21 - 224
Target Start/End: Complemental strand, 1926546 - 1926343
Alignment:
| Q |
21 |
actaaagtatacatctaaatctaaaaataatataccaccacattttaacacatgcgcagggtgtgtgagtgttgtaaattatagatagtcttcaatggaa |
120 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1926546 |
actaaagtatacatctaaatctaaacataatataccaccacattttaacacatgcgcagggtgtgtgagtgttgtaaattatagatagtcttcaatggaa |
1926447 |
T |
 |
| Q |
121 |
atgttcaaatcctcttgttgttgactgcaagaaactccttgatcatcacccaaaccatcccaccaaaaaacatcatcaggaacaacattatccatatgat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1926446 |
atgttcaaatcctcttgttgttgactgcaagaaactccttgatcatcacccaaaccatcccaccaaaaaacatcatcaggaacaacattatccatatgat |
1926347 |
T |
 |
| Q |
221 |
tcat |
224 |
Q |
| |
|
|||| |
|
|
| T |
1926346 |
tcat |
1926343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University