View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_72 (Length: 238)
Name: NF5811_low_72
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 5434319 - 5434528
Alignment:
| Q |
11 |
atcatcaatagtgaaggacattgaatttcgacatttaaatatagatgaaaatgttaaaacccttgatagaaatatacacaccgcaagaagatctccttnn |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5434319 |
atcatcaatagtgaaggacattgaatttcgacatttaaatatagatgaaaatgttaaaacccttgatagaaatatacacaccgcaagaagatctccttag |
5434418 |
T |
 |
| Q |
111 |
nnnnnngctacgaagcaggtccaggatgatctattgtgaaggacaatgaatttccacacttgaatatggatgaaaaatgtcaaaacccttttgtagaaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5434419 |
aaaaaagctacgaagcaggtccaggatgatctattgtgaaggacaatgaatttccaaacttgaatatggatgaaaaatgtcaaaacccttttgtagaaca |
5434518 |
T |
 |
| Q |
211 |
acattaaagc |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
5434519 |
acattaaagc |
5434528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University