View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_73 (Length: 238)
Name: NF5811_low_73
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 34741656 - 34741445
Alignment:
| Q |
16 |
atatcaaattgaagtcaccattctctttattgcaacaatcatatagatcaaacgatacatgaataaagcaatattctttgcaatttttgctgcaagtttt |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34741656 |
atatcaaattgaagtcaccattctttttattgcaacaatcatatagatcaaacgatacatgaataaagcaatattctttgcaatttttgctgcaagtttt |
34741557 |
T |
 |
| Q |
116 |
gaatgaacaaaagttctattttctatttatttcttatttttagt----cttatgtgatcagccttctgatcttttagttggtctatgttgtaactgtgtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
34741556 |
gaatgaacaaaagttctattttctatttatttcttatttttagtcttacttatgtgatcagccttctaatctcttagttggtctatgttgtaactgtgtt |
34741457 |
T |
 |
| Q |
212 |
ggtgaaactttt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34741456 |
ggtgaaactttt |
34741445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University