View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_79 (Length: 229)
Name: NF5811_low_79
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_79 |
 | |
|
| [»] scaffold0032 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 9292046 - 9291851
Alignment:
| Q |
19 |
atttgccagttgagctaggacttctcgactattttaatttaattatagagtaaatcgtcaatttaattagttcctaagggtatcaattgccctctcgtaa |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
9292046 |
atttgccagttgagctaggacttctagactattttgatttaattatagagtaaatcgtcaatttaattagttcctaagggtatcaattgctctctcctaa |
9291947 |
T |
|
| Q |
119 |
tatggtttcttcactatatagtatatatactagaaagataataatagtttatagattaaatgaagggtttaccgttaattctatttctatttcatctc |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9291946 |
catggtttcttcactatatagta--tatactagaaagataataatagtttagagattaaattaagggtttactgttaattctatttctatttcatctc |
9291851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 32023278 - 32023234
Alignment:
| Q |
20 |
tttgccagttgagctaggacttctcgactattttaatttaattat |
64 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
32023278 |
tttgccagttgagctaggacttctggattatttaaatttaattat |
32023234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 56509 - 56464
Alignment:
| Q |
19 |
atttgccagttgagctaggacttctcgac-tattttaatttaatta |
63 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
56509 |
atttgccagttgagctaggacttctagacttattttattttaatta |
56464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University