View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_82 (Length: 227)
Name: NF5811_low_82
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_82 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 6 - 117
Target Start/End: Complemental strand, 29395222 - 29395111
Alignment:
| Q |
6 |
aagttggctaccggtgtccaacaccattggttgagtttgaggtggtgttccaatggggaggttaatgatgagagccatcgaatatttgaaggaaaatttg |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29395222 |
aagttggctaccagtgtccaacaccattggttgagtttgaggtggtgttccaatggggaggttaatgatgagagccatcgaatatttgaaggaaaatttg |
29395123 |
T |
|
| Q |
106 |
tagttatatgaa |
117 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29395122 |
tagttatatgaa |
29395111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 167 - 227
Target Start/End: Complemental strand, 29395070 - 29395010
Alignment:
| Q |
167 |
aaaatagttgagatgtgtatagcatttttgaggttgtgtcattggagagagagagtgatgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29395070 |
aaaatagttgagatgtgtatagcatttttgaggttgtgtcattggagagagagagtgatgt |
29395010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University