View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_85 (Length: 219)
Name: NF5811_low_85
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_85 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 1458490 - 1458710
Alignment:
| Q |
1 |
tttggtataatacttctcttctctccatctctctccnnnnnnngtttgttcatgtttatgcctcaaaaaatattggtcatgttatttattacgtcaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1458490 |
tttggtataatacttctcttctctccatctctctcctttttttgtttgttcatgtttatgcctcaaaaaatattggtcatgttatttattacgtcgatat |
1458589 |
T |
 |
| Q |
101 |
ttccatcaaatcaaatattattaatgtttaatttcttagagatctatatatatgaaaaatttacaatcatg-atga-nnnnnnnngttgataaatcatga |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
1458590 |
ttccatcaaatcaaatattattaatgtttaatttcatagagatcagtatatatgaaaaatttacaatcatgaatgatttttttttgttaataaatcatga |
1458689 |
T |
 |
| Q |
199 |
atgatgctttaaatatgccgt |
219 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1458690 |
atgatgctttaaatatgccgt |
1458710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University