View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5811_low_90 (Length: 211)
Name: NF5811_low_90
Description: NF5811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5811_low_90 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 12 - 194
Target Start/End: Original strand, 29394574 - 29394756
Alignment:
| Q |
12 |
atgaaattacaaaatcattaactaagacacaccttccaaattgaataaggtatgatcacaagatgtgtagagatctgtgtttatgtctttgctaaagaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29394574 |
atgaaattacaaaatcattaactaagacacaccttccaaattgaataaggtatgatcacaagatgtgtagagatctgtgtttatgtctttgctaaagaat |
29394673 |
T |
|
| Q |
112 |
aataatatgatnnnnnnnnnnnnnnnnnnnaccgaacaaaattcgtcttcttttgtttccttcctctcttttctttcctcccc |
194 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29394674 |
aataatatgatccaccccaccccacccccaaccgaacaaaacgcgtcttcttttgtttccttcctctcttttctttcctcccc |
29394756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University