View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5812-Insertion-10 (Length: 162)
Name: NF5812-Insertion-10
Description: NF5812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5812-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 9 - 162
Target Start/End: Complemental strand, 20179106 - 20178953
Alignment:
| Q |
9 |
ctcagtttccgatccttgcgtttcaacggttcaatcaccgagtctctaaaccggcacggtaaagcttggttccttcctcttttagaccgaaccaccggtt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20179106 |
ctcagtttccgatccttgcgtttcaacggttcaatcaccgagtctctaaaccggcacggtaaagcttggttccttcctcttttagaccgaaccaccggtt |
20179007 |
T |
|
| Q |
109 |
cattttcatacaaatccacaacaacccgagtcattaactccgttccggttcgtt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20179006 |
cattttcatacaaatccacaacaacccgagccattaactccgttccggttcgtt |
20178953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University