View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5812_high_10 (Length: 203)
Name: NF5812_high_10
Description: NF5812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5812_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 23 - 182
Target Start/End: Original strand, 20178947 - 20179106
Alignment:
| Q |
23 |
cagagaaacgaaccggaacggagttaatgactcgggttgttgtggatttgtatgaaaatgaaccggtggttcggtctaaaagaggaaggaaccaagcttt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20178947 |
cagagaaacgaaccggaacggagttaatggctcgggttgttgtggatttgtatgaaaatgaaccggtggttcggtctaaaagaggaaggaaccaagcttt |
20179046 |
T |
 |
| Q |
123 |
accgtgccggtttagagactcggtgattgaaccgttgaaacgcaaggatcggaaactgag |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20179047 |
accgtgccggtttagagactcggtgattgaaccgttgaaacgcaaggatcggaaactgag |
20179106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University