View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5812_low_11 (Length: 203)

Name: NF5812_low_11
Description: NF5812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5812_low_11
NF5812_low_11
[»] chr4 (1 HSPs)
chr4 (23-182)||(20178947-20179106)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 23 - 182
Target Start/End: Original strand, 20178947 - 20179106
Alignment:
23 cagagaaacgaaccggaacggagttaatgactcgggttgttgtggatttgtatgaaaatgaaccggtggttcggtctaaaagaggaaggaaccaagcttt 122  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20178947 cagagaaacgaaccggaacggagttaatggctcgggttgttgtggatttgtatgaaaatgaaccggtggttcggtctaaaagaggaaggaaccaagcttt 20179046  T
123 accgtgccggtttagagactcggtgattgaaccgttgaaacgcaaggatcggaaactgag 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20179047 accgtgccggtttagagactcggtgattgaaccgttgaaacgcaaggatcggaaactgag 20179106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University