View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5812_low_2 (Length: 383)
Name: NF5812_low_2
Description: NF5812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5812_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 365
Target Start/End: Complemental strand, 38058878 - 38058535
Alignment:
| Q |
1 |
tttgaatttgcagcttaatggctgaccgtgttcacccccgtgactcaccaccagtttctccacagtccgccgccgttgctccaaaaccaccgttggataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38058878 |
tttgaatttgcagcttaatggctgaccgtgttcacccccgtgactcaccaccagtttctc---------------------caaaaccaccgttggataa |
38058800 |
T |
 |
| Q |
101 |
gcctgttccaccaccgggaacttatgtcatcaagattccgaaagacatagtccaccgagtccctccaccggagaatgctcgccgttacgaacaatacaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38058799 |
gcctgttccaccaccgggaacttatgtcatcaagattccgaaagacatagtccaccgagtccctccaccggagaatgctcgccgttacgaacaatacaca |
38058700 |
T |
 |
| Q |
201 |
cgcaagaaacaccgtcggaaccgtcattgctgctgcctttgctggttcatcggaataattttcatcctcatcgcgctccttggtattgccgccggcattt |
300 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38058699 |
cgaaagaaacaccgtcggaaccgtcattgctgctgcctttgctggttcattggaataattttcatcctcatcgcgctccttggtattgccgccggcattt |
38058600 |
T |
 |
| Q |
301 |
tctaccttgttttccgtccaaaagcaccaaactacaccatcgaaaacatcaccattagaggaatc |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38058599 |
tctaccttgttttccgtccaaaagcaccaaactacaccatcgaaaacatcaccattagaggaatc |
38058535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University