View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5812_low_8 (Length: 233)
Name: NF5812_low_8
Description: NF5812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5812_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 13 - 130
Target Start/End: Complemental strand, 6031965 - 6031848
Alignment:
| Q |
13 |
gtttcaacatagctgcatagtcagcaacagcccaatttgttagtgtatcaggattaattggaacatgattatgagttgtttgtgtgtagggaacagaaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6031965 |
gtttcaacatagctgcatagtcagcaacagcccaatttgttagtgtatcaggattaattggaacatgattatgagttgtttgtgtgtagggaacagaaat |
6031866 |
T |
 |
| Q |
113 |
agtaggatcatgaagaaa |
130 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6031865 |
agtaggatcatgaagaaa |
6031848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 167 - 233
Target Start/End: Complemental strand, 6031802 - 6031736
Alignment:
| Q |
167 |
attagaagaagcattttgatcaggggtaagaaaagtaaaaggagggtatgagtgtgaagaagaagat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6031802 |
attagaagaagcattttgatcaggggtaagaaaagtaaaaggagggtatgagtgtgaagaagaagat |
6031736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University