View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5813-Insertion-10 (Length: 256)
Name: NF5813-Insertion-10
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5813-Insertion-10 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 31 - 256
Target Start/End: Complemental strand, 41805724 - 41805499
Alignment:
| Q |
31 |
tatagatgggttcacattgctctctggccccggcgagtctttgatatgaattcctttagatagtcattgcgctccctgtgataatcaatccgcaaacaaa |
130 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41805724 |
tatagatgggttcacactgctctctggccccggcgagtctttgatatgaattcctttagatagtcattgcgctccctgtgataatcaatccgcaaacaaa |
41805625 |
T |
 |
| Q |
131 |
gctgcctgatggcctccctcttttcctctcccaagttcaacataccctcctctttctcttccatcaacttctctagctcttcaactcacttcttaagttc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41805624 |
gctgcctgatggcctccctcttttcctctcccaagttcaacataccctcctctttctcttccatcaacttctctagctcttcaactctcttcttaagttc |
41805525 |
T |
 |
| Q |
231 |
aacaacaattgttgtcacattcatct |
256 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41805524 |
aacaacaattgttgtcacattcatct |
41805499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 48 - 256
Target Start/End: Complemental strand, 41799321 - 41799113
Alignment:
| Q |
48 |
tgctctctggccccggcgagtctttgatatgaattcctttagatagtcattgcgctccctgtgataatcaatccgcaaacaaagctgcctgatggcctcc |
147 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| |||||| ||| |||| | | ||| | |||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
41799321 |
tgctctctggcccctgcgtgtctttgatatgatttccttgagacggtcactactctcacggtgataatcaatccacaaacagagctgcctgatggcctcc |
41799222 |
T |
 |
| Q |
148 |
ctcttttcctctcccaagttcaacataccctcctctttctcttccatcaacttctctagctcttcaactcacttcttaagttcaacaacaattgttgtca |
247 |
Q |
| |
|
||||||||||||||||| | ||| || || ||||||||||||| |||| |||||||||||||| ||||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
41799221 |
ctcttttcctctcccaaatccaatatgccttcctctttctctttcatcgacttctctagctctccaactgtcttcttaagttcaacaacagttgctgtca |
41799122 |
T |
 |
| Q |
248 |
cattcatct |
256 |
Q |
| |
|
||||||||| |
|
|
| T |
41799121 |
cattcatct |
41799113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 50 - 256
Target Start/End: Complemental strand, 41812535 - 41812329
Alignment:
| Q |
50 |
ctctctggccccggcgagtctttgatatgaattcctttagatagtcattgcgctccctgtgataatcaatccgcaaacaaagctgcctgatggcctccct |
149 |
Q |
| |
|
|||||||||||| |||||||||| |||| | |||| |||||| |||| | ||| | ||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
41812535 |
ctctctggcccctttgagtctttgagatgattcccttgagatagacattacactcgcggtgataatcaatcaacaaacagagctgcctgatggcctccct |
41812436 |
T |
 |
| Q |
150 |
cttttcctctcccaagttcaacataccctcctctttctcttccatcaacttctctagctcttcaactcacttcttaagttcaacaacaattgttgtcaca |
249 |
Q |
| |
|
||||||||||||||| | ||| || || ||||||||||||| |||||||||| ||||||||||||| ||||||||||||| ||||| ||| ||||||| |
|
|
| T |
41812435 |
cttttcctctcccaaatccaatattccttcctctttctcttttatcaacttctgtagctcttcaactgtcttcttaagttcatcaacagttgctgtcaca |
41812336 |
T |
 |
| Q |
250 |
ttcatct |
256 |
Q |
| |
|
||||||| |
|
|
| T |
41812335 |
ttcatct |
41812329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University