View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5813-Insertion-13 (Length: 131)
Name: NF5813-Insertion-13
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5813-Insertion-13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 14 - 131
Target Start/End: Complemental strand, 52475725 - 52475607
Alignment:
| Q |
14 |
gtatttaataaaa-tattgtgatttgctgattaaatagaaggagcaacttgagattgagaaaaaaggccgtggaggtgtgtatcttacattaaaggatct |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52475725 |
gtatttaataaaaatattgtgatttgctgattaaatagaaggagcaacttcagattgagaaaaaaggccgtggaggtgtgtatcttacattaaaggatct |
52475626 |
T |
 |
| Q |
113 |
ttctgagatgcaatatgct |
131 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52475625 |
ttctgagatgcaatatgct |
52475607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University